HA! env regions from O'Keefe are very similar to ..... LOL

[V99]

Ok this is the patent.
http://www.freepatentsonline.com/y2012/0107338.html

First env I BLASTED.

Quote:(SEQ ID NO: 28)
CCTCAACCTCACCAGTCCCGACAAAACCCAAGAGTGCTGGTTGTGTCTGGTATCGGGACCCCCCTACTACGAAGGGGT
TGCCGTCCTAGGTACCTACTCCAACCATACCTCTGCCCCAGCTAACTGCTCCGTGGCCTCCCAACACAAGCTGACCCT
GTCCGAAGTGACCGGACAGGGACTCTGCGTAGGAGCAGTTCCCAAAACCCATCAGGCCCTGTGTAATACCACCCAGAA
GACGAGCGACGGGTCCTACTATCTGGCTGCTCCCGCCGGGACCATCTGGGCTTGCAACACCGGGCTCACTCCCTGCCT
ATCTACTACTGTACTCAACCTCACCACCGATTACTGTGTCCTGGTTGAGCTCTGGCCAAAGGTGACCTACCACTCCCC
TGGTTATGCTTATGGCCAGTTTGAGAGAAAAACCAAATATAAAAGAGAGCCGGTGTCATTAACTCTGGCCCTGCTGTT
GGGAGGACTTACTATGGGCGGCATAGCTGCAGGAGTAGGAACAGGGACTACAGCCCTAGTGGCCACCAAACAATTCGA
GCAGCTCCAGGCAGCCATACATACAGACCTTAGGGCCTTAGAAAAATCAGTCAGTGCCCTAGAAAAGTCTCTGACCTC
GTTGTCTGAGGTGGTCCTACAGAACCGGAGAGGATTAGATCTGCTGTTCCTAAAAGAAGGAGGATTATGTGCTGCCCT
AAAAGAAGAATGCTGTTTCTACGCGGACCACACTGGCGTAGTGAGAGATAGCATGGCAAAGCTAAGAGAAAGGTTAAA
CCAGAGACAAAAATTGTTCGAATCAGGACAAGGGTGGTTTGAGGGACTGTTTAACAGGTCCCCATGGTTCACGACCTT
GATATCCACCATTATGGGCCCCTTGATAATACTTTTATTAATCCTACTCCTCGGACCCTGTATTCTCAACCGCTTGGT
CCAGTTTGTAAAAAAAGAATTTCGGGGGGGCAGGCCCTGGTTCTGACCCACAGTATCCCCACTCAATTAATAAATCCC

Ok here is the first similarities.

[attachment=115]

But this one caught my eye. He he he

Quote:Mouse endogenous murine leukemia virus clone MMX-CZ3 envelope
protein (env) gene, partial cds; and U3 region of long terminal
repeat, complete sequence
Length=1393

Score = 1784 bits (966), Expect = 0.0
Identities = 1000/1016 (98%), Gaps = 4/1016 (0%)
Strand=Plus/Plus

Because the author who entered that sequence into the Genbank was...

Quote:AUTHORS Tomonaga,K. and Coffin,J.M.

http://www.ncbi.nlm.nih.gov/nucleotide/3...XEVAP4201N

[V99]

The other env is also fascinating.

Quote:(SEQ ID NO: 29)
CCATGCCTTGCAAAATGGCGTTACTGCAGCTAGCTTGCTAAGCCTGATGGTGGGGTCTTTCATTCCCCCCTCTTTCTG
GAAACTGAATAAAATCTTTTATTCACGTGATTCCACTTCTTCTGGATCTATTGATTTGAGTTGGTGATACTGTTGGGT
CAAAGCCAGGGCCTGCACTACCGAAATTCTGTCTTTTACAAACTGGACCAAGCGGTTGAGAATACAGGGTCCGAAGAG
TAGGATTAATAAAAGTATTATCAAGGGGCCCATAATGGTAGATATTAAGGTCGTGAACCATGGGGACCTGTTAAACAG
TCCCTCAGACCACCCTTGTCCTGATTCGAACAATTTTTGTCTCTGGTTCAACCTTTCTCTTAGCTTTGCCATGCTATC
TCTTACTACGCCAGTGTGGTCCGCGTAGAAACAGCATTCTTCTTTTAGGGCAGCACATAATCCTCCTTCTTTTAGGAA
CAGTAGATCTAATCCCCTCCGGTTCTGTAGGACCACCTCAGACAACGAGGTCAGAGACTTTTCTAGGGCACTGACTGA
CTTTTCTAAAGCCCCAAGGTCTGTATGTATGGCTGCCTGGAGCTGCTCGAATTGTTTGGTGGCCACTAGGGCTGTAGT
CCCGGTTCCTACTCCTGCAGCTATGCCGCCCATAGTAAGTCCTCCCAACAGCAGGGCCAGAGTTAATGACACCGGCTC
TCTTTTATATTTGGTTTTTTTCTCAAACTGGCCATAAACATAACCAGGGGAGTGGTAGGTCACCTTTGGCCAGAGCTC
AACCAGGACACAGTAATCGGTGGTTAAGTTAAGCACAGTAGTAGATAGACAGGGAGTGAGCCCGGTGCTGCAGGCCCA
AATGGTCCCGGCGGGAGAGGCCAAATAGTAGGACCCGTCGCTCGTCTTCTGGGTGGTATTACACAGGGCCTGATGGGG
TTTTGGGGAACTGCTCCTACGCAGAAACCCTGGTCCGGTCCCTTCGGACAGGGTCACCTTGGGTTGGGGAGGCCCGGA
ACAGTTAGCTGGGGCAAAAAAAGGGTGGGAAAAGGTACC

[attachment=116]

So the viruses there are

Quote:Identities = 1006/1031 (98%), Gaps = 7/1031 (1%)

Quote:Mus musculus mobilized endogenous polytropic provirus clone 51 truncated gag-pol polyprotein (gag) and envelope protein (env) genes, complete cds
GenBank: FJ544578.1

http://www.ncbi.nlm.nih.gov/nucleotide/2...XFKHTGA01N


and

Quote:Identities = 1006/1031 (98%), Gaps = 7/1031 (1%)

Quote:Mus musculus polytropic MLV-related provirus NE2 integrase (pol) gene, partial cds; envelope polyprotein (env) gene, complete cds; and long terminal repeat, partial sequence
GenBank: AY219551.2

http://www.ncbi.nlm.nih.gov/nucleotide/3...XFKHTGA01N

This is from a strain of mice called NFS.

Quote:Common Spiny Mice Acomys cahirinus from north- and south-facing slopes (NFS and SFS) of the same valley, which represented 'Mediterranean' and 'desert' habitats, respectively.

http://www.jstor.org/discover/10.2307/35...9033795817


So her env's are both poly. One is similar to wild mice and other to a Coffin env.

[asleep]

I feel like O'Keefe has broken this thing wide open. The VP62 creation story was always a tricky ploy that required prevention of new, sufficiently divergent sequences from surfacing, which O'Keefe seems to now have provided. She has rendered Coffin's immaculate recombination moot. All that story telling, down the drain.

The timing is good too, as the Lipkin study will look foolish if it doesn't take this new information into account.

It would be interesting to find out if the primers used in all the 0/0 studies would have picked up these new ENV ang GAG sequences that O'Keefe found...

[anciendaze]

No comment on the match to pre-XMRV2?

[CTD]

Anciendaze I think V99 did comment about pre-XMRV2 which i thought was Coffin's theory (at least in part)?

Quote:''So her env's are both poly. One is similar to wild mice and other to a Coffin env''.

Its' like reading alien language to me though...[]32C;DA<>da&12df.... :)

[Angela Kennedy (Staff)]

(05-25-2012 01:23 AM)asleep Wrote:  I feel like O'Keefe has broken this thing wide open. The VP62 creation story was always a tricky ploy that required prevention of new, sufficiently divergent sequences from surfacing, which O'Keefe seems to now have provided. She has rendered Coffin's immaculate recombination moot. All that story telling, down the drain.

The timing is good too, as the Lipkin study will look foolish if it doesn't take this new information into account.

It would be interesting to find out if the primers used in all the 0/0 studies would have picked up these new ENV ang GAG sequences that O'Keefe found...

Those are good points asleep (got the right person this time lol!)

However, can we expect the usual dirty tricks to discredit this work? Have we seen any already?

[mala]

Quote:Those are good points asleep (got the right person this time lol!)

However, can we expect the usual dirty tricks to discredit this work? Have we seen any already?

I bet okeefe steals computers....she will probably pay for that by having a gagorder and loose her job.

[Angela Kennedy (Staff)]

Interestingly (though, from previous performance, rather predictably) there is nothing about this on the Bad Science Forum as yet.

But this usually happens. They take a bit of time to gather themselves together to go on the attack and generate usual discrediting tactics.

I would be absolutely astounded if they did the right thing and evaluated this work on its merits.

Same goes for ERV :(

[V99]

(05-25-2012 02:00 AM)anciendaze Wrote:  No comment on the match to pre-XMRV2?

Oh you spoiled it.


Identities = 995/1016 (98%), Gaps = 4/1016 (0%)
Yep one of O'Keefe's env is similar to PreXMRV-2.

Lab mice env in human retrovirues again. How many viruses lead back to PreXMRV-2? How many recombinants has it created and with what other viruses?

O'Keefe's other env is similar to a wild mouse virus.

And what does that say about Coffin' knowledge of PreXMRV-2 prior to 2010.

PreXMRV-2 and Coffin's other virus AF017530 are this similar.
Identities = 1319/1341 (98%), Gaps = 1/1341 (0%)

So what do we conclude. Diff strains? Contamination? Or the same virus. Hard when we don't stick to what really determines when a strain is not the same strain. Like VP42, VP35 being different strains to one another, and not the XMRV virus.

[V99]

(05-25-2012 11:24 AM)mala Wrote:  

Quote:Those are good points asleep (got the right person this time lol!)

However, can we expect the usual dirty tricks to discredit this work? Have we seen any already?

I bet okeefe steals computers....she will probably pay for that by having a gagorder and loose her job.

Anything happens to O'Keefe and more patients will catch on what is going down. They don't want that.